Unveiling the dynamic expression of PR-1 during Musa spp. infection by Fusarium oxysporum fsp. Cubense: a cloning and characterization study.

BACKGROUND: Pathogen-related proteins (PR) are pivotal in plant defense, combating diverse biotic and abiotic stresses. While multiple gene families contribute to banana resistance against Fusarium oxysporum f sp. cubense (Foc), Pseudocercospora eumusae, and Pratylenchus coffeae, the significance of PR-1 genes in defense is paramount. METHODS: Three PR-1 genes, up-regulated under diverse biotic stresses, were cloned from both resistant and susceptible cultivars of Foc, P. eumusae, and P. coffeae. Molecular characterization, phylogenetic analysis, and docking studies with the Foc TR4 CP gene were conducted. RESULTS: Through transcriptomic and real-time studies, three PR-1 genes (Ma02_g15050, Ma02_g15060, and Ma04_g34800) from Musa spp. were identified. These genes exhibited significant up-regulation in resistant cultivars when exposed to Foc, P. eumusae, and P. coffeae. Cloning of these genes was successfully performed from both resistant and susceptible cultivars of Foc race 1 and TR4, P. eumusae, and P. coffeae. Distinct characteristics were observed among the PR-1 genes, with groups 1 and 2 being acidic with signal peptides, and group 3 being basic without signal peptides. All cloned PR-1 proteins belonged to the CAP superfamily (PF00188). Phylogenetic analysis revealed clustering patterns for acidic PR-1 proteins, and KEGG orthology showed associations with vital pathways, including MAPK signaling, plant hormone signal transduction, and plant-pathogen interaction. Secondary and tertiary structure analyses confirmed sequence conservation across studied species. Docking studies explored interactions between the cerato-platanin (CP) gene from Foc TR4 and Ma02_g15060 from banana, suggesting the potential hindrance of PR-1 antifungal activity through direct interaction. CONCLUSIONS: The findings underscore the crucial role of cloned PR-1 genes in banana plant defense mechanisms against a broad spectrum of biotic stresses. These genes, especially those in groups 1 and 2, hold promise as candidates for developing stress-tolerant banana cultivars. The study provides valuable insights into the molecular aspects of banana defense strategies, emphasizing the potential applications of PR-1 genes in enhancing banana resilience.

Genome-wide identification, characterization of expansin gene family of banana and their expression pattern under various stresses.

Expansin, a cell wall-modifying gene family, has been well characterized and its role in biotic and abiotic stress resistance has been proven in many monocots, but not yet studied in banana, a unique model crop. Banana is one of the staple food crops in developing countries and its production is highly influenced by various biotic and abiotic factors. Characterizing the expansin genes of the ancestor genome (M. acuminata and M. balbisiana) of present day cultivated banana will enlighten their role in growth and development, and stress responses. In the present study, 58 (MaEXPs) and 55 (MbaEXPs) putative expansin genes were identified in A and B genome, respectively, and were grouped in four subfamilies based on phylogenetic analysis. Gene structure and its duplications revealed that EXPA genes are highly conserved and are under negative selection whereas the presence of more number of introns in other subfamilies revealed that they are diversifying. Expression profiling of expansin genes showed a distinct expression pattern for biotic and abiotic stress conditions. This study revealed that among the expansin subfamilies, EXPAs contributed significantly towards stress-resistant mechanism. The differential expression of MaEXPA18 and MaEXPA26 under drought stress conditions in the contrasting cultivar suggested their role in drought-tolerant mechanism. Most of the MaEXPA genes are differentially expressed in the root lesion nematode contrasting cultivars which speculated that this expansin subfamily might be the susceptible factor. The downregulation of MaEXPLA6 in resistant cultivar during Sigatoka leaf spot infection suggested that by suppressing this gene, resistance may be enhanced in susceptible cultivar. Further, in-depth studies of these genes will lead to gain insight into their role in various stress conditions in banana. Supplementary Information: The online version contains supplementary material available at 10.1007/s13205-021-03106-x.

Development of fusarium wilt resistant mutants of Musa spp. cv.Rasthali (AAB, Silk subgroup) and comparative proteomic analysis along with its wild type.

MAIN CONCLUSION: Induced mutagenesis using embryogenic cell suspension (ECS) explants with toxin based screening is an effective tool to create non-chimeral Fusarium wilt resistant mutants in banana. Global proteomics unravel the molecular mechanism behind resistance. Race 1 of Fusarium wilt is a serious threat to Musa spp. cv.Rasthali (AAB, Silk subgroup) which is a choice variety traditionally grown in most of the south East Asian countries. Resistant gene introgression into susceptible varieties through conventional breeding has several limitations and the predominant ones being sterility and long generation time. Under such circumstances, induced mutagenesis combined with toxin based in vitro screening remains as the viable alternative for the development of fusarium wilt resistant Rasthali. Therefore, induced mutagenesis was attempted by using ethylmethane sulfonate (EMS) in embryogenic cell suspension (ECS) of Rasthali followed by in vitro screening for fusarium wilt resistance using new generation toxins and pot screening through challenge inoculation with Foc race 1. This ultimately resulted in the identification of 15 resistant lines. Global proteomic analysis in one of the resistant mutant lines namely NRCBRM15 and its wild type revealed 37 proteins, of which 20 showed differential expression. Out of 20 proteins, nineteen were significantly abundant in NRCBRM15 and only one was abundant in wild Rasthali. A total of nine genes based on protein expression were further validated using quantitative real time polymerase chain reaction (qRT-PCR). Annotation results revealed that some of the genes namely Enolase, ATP synthase-alpha subunit, Actin 2, Actin 3,-glucanase, UTP-glucose-1-phosphate uridylyltransferase, Respiratory burst oxidase homolog, V type proton ATPase catalytic subunit A and DUF292 domain containing protein are involved in diverse functions such as carbohydrate metabolism, energy production, electron carrier, response to wounding, binding proteins, cytoskeleton organization, extracellular region, structural molecule and defense.

Genome-wide analysis of pathogenesis-related protein 1 (PR-1) gene family from Musa spp. and its role in defense response during stresses.

Pathogenesis related protein-1 (PR-1) is the most abundantly produced protein during defense response against many biotic and abiotic stresses. However, knowledge on PR-1 gene family and its evolutionary relationship in banana is very limited. In order to study the potential role of PR-1 genes in banana, genome wide identification, structure analysis and expressions were performed. A total of 15 and 11 PR-1 genes were identified from A and B genomes of banana and the proteins encoded by this gene family are of varying lengths and harbor conserved domains and motifs. PR-1 genes are unevenly dispersed on 11 chromosomes with segmental duplication in both A and B genome, suggesting an important contribution of duplication in expansion of PR-1 gene family in banana. qRT-PCR analysis of PR-1 gene showed positive correlation with the RNAseq data under various stresses and examination of expression pattern of selected MaPR-1 genes in banana revealed its role in biotic and abiotic stresses in general and fusarium wilt in particular. This study provides significant insight into the functions of PR-1 genes which can be further exploited as a promising candidate for developing multiple stress tolerant banana varieties.

Development of PCR-Based Race-Specific Markers for Differentiation of Indian Fusarium oxysporum f. sp. cubense, the Causal Agent of Fusarium Wilt in Banana.

Fusarium wilt caused by Fusarium oxysporum f. sp. cubense (Foc), is the most lethal soil-borne fungal pathogen infecting bananas. Foc race 1 (R1) and 4 (R4) are the two most predominant races affecting the economically important Cavendish group of bananas in India. A total of seven vegetative compatibility groups (VCGs) from three pathogenic races were isolated during our field survey and were found to be highly virulent towards cv. Grande Naine. According to comparative genome analyses, these Indian Foc VCGs were diverse in genomic organization and effector gene profiles. As a result, false-positive results were obtained with currently available molecular markers. In this context, the study has been initiated to develop PCR-based molecular markers for the unambiguous identification of Indian Foc R1 and R4 isolates. Whole-genome sequences of Foc R1 (GCA_011316005.3), Foc TR4 (GCA_014282265.3), and Foc STR4 (GCA_016802205.1), as well as the reference genomes of Foc (ASM799451v1) and F. oxysporum f. sp. lycopersici (Fol; ASM14995v2), were aligned to identify unique variable regions among the Foc races. Using putative chromosome and predicted gene comparison, race-specific unique Foc virulence genes were identified. The putative lineage-specific identified genes encoding products secreted in xylem (SIX) that may be necessary for disease development in the banana. An in silico analysis was performed and primers were designed from a region where sequences were dissimilar with other races to develop a specific marker for Foc R1, R4, TR4, and STR4. These race-specific markers allowed target amplification in the characterized highly virulent Foc isolates, and did not show any cross-amplification to any other Foc races, VCGs or banana pathogens, Fusarium species, and non-pathogenic Fusarium oxysporum isolates. The study demonstrated that the molecular markers developed for all the three Foc races of India could detect the pathogen in planta and up to 0.025 pg µL-1 DNA levels. Thus, the markers developed in this study are novel and could potentially be useful for the accurate diagnosis and detection of the Indian Foc races which are important for the effective management of the disease.

First report of rhizome rot of banana caused by Klebsiella variicola in India.

Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5' - AGAGTTTGATCCTGGCTCAG - 3'; 1492 R 5' - GGTTACCTTGTTACGACTT - 3') and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in nutrient broth for 48 h at 37±1°C and the cells were harvested by centrifugation. Five milliliters of the culture suspension (2×108 CFUmL-1) taken in a syringe was injected into rhizomes of three month old tissue cultured Grand Naine plants. Each bacterial isolate was injected into eight banana plants at soil level. Appropriate controls were maintained. Inoculated plants were maintained in a glasshouse at 32±2°C and after 30-35 days, rhizome rot symptoms appeared in all the three bacterial isolates inoculated plants but in none of the control plants. The Koch's postulates were proved by re-isolation and identification.To the best of our knowledge, this is the first report of K. variicola causing rhizome rot disease of banana in India.

Draft Genome Resource of a Novel Virulent Fusarium oxysporum f. sp. cubense Race 1 Strain (VCG 0124) Infecting Cavendish (AAA) Group of Banana in India.

Fusarium oxysporum f. sp. cubense is one of the most destructive soilborne fungi causing Fusarium wilt disease in banana. Generally, F. oxysporum f. sp. cubense race 1 (R1) severely affects most of the banana varieties, except Cavendish banana (AAA). Here, we present the draft genome of an isolate of VCG 0124, a novel virulent R1 strain that severely affects the Cavendish group of banana isolated from the Theni district of Tamil Nadu, India. The genome assembly of R1 comprises 61,471,473 bp with 88 contigs and 18,377 protein-coding regions. The genome contains homologs of F. oxysporum f. sp. cubense race-specific secreted-in-xylem (SIX) genes SIX1, SIX5, SIX9, and SIX13. The absence of SIX4 and SIX6 and deletion of a peptide in SIX1 virulence factor genes in the R1 (VCG 0124) strain might be the contributing factor for strains infecting Cavendish banana in India.

First report of Fusarium oxysporum f.sp. cubense VCG 0125 and VCG 01220 of Race 1 infecting Cavendish bananas(Musa sp. AAA) in India.

Fusarium wilt caused by Fusarium oxysporum f.sp. cubense (Foc) is the most devastating disease affecting commercial and subsistence cultivation of banana (Musa spp.) worldwide. Generally, the Cavendish bananas are resistant to Foc race 1 that destroyed cv. 'Gros Michel' (AAA) and susceptible to tropical race 4 (TR4), which is causing severe epidemics in different banana-growing countries including India (Thangavelu et al. 2019). In 2019, a roving survey was conducted in major banana growing states of India such as Bihar, Uttar Pradesh, Gujarat and Tamil Nadu to assess the incidence of Fusarium wilt disease in Cavendish bananas and also to characterize the pathogens by different methods including Vegetative Compatibility Grouping (VCG) and molecular methods. The Fusarium wilt incidence in cv. Grand Naine (Cavendish group-AAA) was 6-65% in Bihar, 30-45% in Uttar Pradesh, 5-15% in Gujarat and 15- 21% in Tamil Nadu. For characterization, a total of 61 samples from the Fusarium wilt infected Cavendish bananas were collected and single spore culture of Foc was obtained. The morphological characterization revealed the presence of one to two oval- to kidney-shaped cells in false heads and sickle-shaped macroconidia and a foot-shaped basal cell. The pathogenicity was demonstrated by adopting randomized block design with five replications on cv. Grand Naine. The Koch's postulate was successfully completed by re-isolation of the inoculated Foc pathogen and characterization by PCR method. The VCG analysis carried out using nit-M testers of all known VCGs indicated the presence of VCG 0125 from the Foc samples collected from cv. Grand Naine grown in Uttar Pradesh (Siswabazar of Maharakanj district) and Tamil Nadu (Cumbum of Theni district), VCG 01220 from the Foc samples collected from cv. Grand Naine grown in Uttar Pradesh (Siswabazar of Maharakanj district) and Gujarat (Kamrej of Surat district,) and VCG 01213/16 from Foc samples collected from Uttar Pradesh (Siswabazar of Maharakanj district) and Bihar (Falka village of Katihar district) . The molecular confirmation of these VCGs 0125, and 01220 (Foc R1) isolates was carried out by PCR method using the primer set SIX6b_210_F and SIX6b_210_R (Carvalhais et al. 2019) for Foc R1, primer sets Foc TR4-F & Foc TR4 -R (Dita et al. 2010) for Foc TR4 and primer set Foc-1/Foc -2 (Lin et al. 2009) for Race 4. The results showed that only the primer set for Foc R1 has generated the expected amplicon size of 210 bp in the Foc isolates of VCG 0125 and 01220. Besides, the sequencing of Translation Elongation Factor (TEF) 1-α gene and BLAST searches in Genbank for the representative Foc isolates of VCG 0125 (Genbank no. MW 286800) showed 99.84% similarity to Foc R1 (KX365393.1) and Foc isolates of VCG 01220 (Genbank no. MW 286803) showed 99.69% similarity to Foc R1 (KX365413.1). Further, a phylogenetic analysis performed using the TEF1-α gene sequences showed that the Foc race 1 isolates (VCGs 0125 and 01220) from India were grouped with known Foc race 1 isolates from Tanzania and Australia. Based on the experimental results the study has confirmed the presence of VCGs 0125 and 01220 of Foc Race 1 in cv. Grand Naine in India. As these VCGs are most widely distributed and do not found to infect Cavendish bananas so far (Mostert et al. 2017), this report is very important from the quarantine and management perspectives. To the best of our knowledge, this is the first report of the occurrence of VCGs 0125 and 01220 of Foc Race 1 in cv. Grand Naine in India.

The distribution and host range of the banana Fusarium wilt fungus, Fusarium oxysporum f. sp. cubense, in Asia.

Fusarium oxysporum formae specialis cubense (Foc) is a soil-borne fungus that causes Fusarium wilt, which is considered to be the most destructive disease of bananas. The fungus is believed to have evolved with its host in the Indo-Malayan region, and from there it was spread to other banana-growing areas with infected planting material. The diversity and distribution of Foc in Asia was investigated. A total of 594 F. oxysporum isolates collected in ten Asian countries were identified by vegetative compatibility groups (VCGs) analysis. To simplify the identification process, the isolates were first divided into DNA lineages using PCR-RFLP analysis. Six lineages and 14 VCGs, representing three Foc races, were identified in this study. The VCG complex 0124/5 was most common in the Indian subcontinent, Vietnam and Cambodia; whereas the VCG complex 01213/16 dominated in the rest of Asia. Sixty-nine F. oxysporum isolates in this study did not match any of the known VCG tester strains. In this study, Foc VCG diversity in Bangladesh, Cambodia and Sri Lanka was determined for the first time and VCGs 01221 and 01222 were first reported from Cambodia and Vietnam. New associations of Foc VCGs and banana cultivars were recorded in all the countries where the fungus was collected. Information obtained in this study could help Asian countries to develop and implement regulatory measures to prevent the incursion of Foc into areas where it does not yet occur. It could also facilitate the deployment of disease resistant banana varieties in infested areas.